Desoxyribonucleinsäure (=DNA)

Der Grund weshalb der Homo spaiens überlebt hat und der Neandertaler nicht, liegt an der kognitiven Leistung. Neandertaler waren definitiv nicht dumm, jedoch hat der Homo sapiens einen entscheidenden Vorteil gehabt. Die Kreativität, die Neugierde und den Mut. Vor allem die Kreativität muss durch eine Genänderung, eine Mutation, aufgetreten sein. Durch diese Änderung ist also das Gen entstanden, das uns heute vom Rest des Tierreichs unterscheidet. Das Wahnsinnsgen. 

Homo sapiens

TACACTCACATTTTTTTGCATATTATCTAGTCCCATGACATTA 

Neandertaler 

TACACTCACATTTTTTTACATATTATCTAGCCCCATGACATTA 

Schimpanse 

TACACTCACA-TTTTTTACATATTATCTAGTCCCATGACATTA 

(Der gleiche Abschnitt des Chromosoms 5 aus dem Genom des Menschen, des Neandertalers und des Schimpansen)